| Introduction | |
| Format | Genomic DNA |
| Description | N/A |
| Technical Data | |
| DNA Change: | c.1801_1802ins30(ACGTTGATTTCAGAGAATATGAATATGATC) |
| AA Change | p.D600_L601ins10 |
| Ploidy | 2.01 |
| Mutation type |
Insertion - In frame
|
| Zygosity | Homozygous |
| Allelic Frequency | 100% |
| Transcript | NM_004119.2 |
| Cosmic ID | N/A |
| Chr position(GRCh37) | N/A |
| Buffer: | Tris-EDTA |
| Product Information | |
| Intended Use | Research Use Only |
| Unit Size | 1ug |
| Concentration | Download for COA |
| Purity | Download for COA |
| DNA electrophoresis | Download for COA |
| Sanger sequencing | ![]() |
| Storage | 2-8℃ |
| Expiry | 36 months from the date of manufacture |
